Primers for the PCR were designed by using NCBI nucleotide data for PAO1 and BLAST of Alkane Monooxygenase (AlkB), the first enzyme in the hydroxylation pathway. Eicosane was used to bring a well-characterized pathway, regular among several bacterial species. AlkB genes of initially screened bacteria suggested that PAO1 is sufficiently homologous for application in P. putida (89% similarity at the nucleotide level). The primers used were

5’ggcacccgaagcttccgtttcc 3’

upstream (48% GC) and

5’gtctgagaattctcctccc 3’

downstream (58% GC), with HindIII and EcoRI restriction sites. Screening of the wild type and mutant strains was done on M9 medium without sucrose, sprayed with a thin layer of target substrate (0.5g/plate), strain success was measured by the presence and rate of zone of clearing. M9 media was used because it limits the carbon source to the target substrate. Napthalene, Catechol, C10-C15 and C20 substrates were also screened.

Initially low degradation of hydrocarbon substrate required assay development through experimentation, however more than a week of lag in the cycle made screening inefficient. To allow more rounds of directed evolution, work was done with M9 media, which has minimal salt content and a source of nitrogen but not of carbon, thus forcing expression of the AlkB pathway to the alkane, present in all of our strains capable of degrading Eicosane and C10-C15.

The two eventual advantages to our screening using zones of clearing for plate-based assays were that the mutants can be immediately compared, allowing for rapid selection for further mutagenesis, and that selection of the best mutants selects for activity on the specific substrate under attention. Screening was very operative at differentiating between active and non-active mutants, which is required at a high rate of mutation, with 3 rounds of 30 cycles PCR producing the final mutant genes. This procedure was optimized to handle 100 mutants/ plate. Screening of thousands of mutants could be possible with the zone of clearing assay, smaller spacing and higher pin density on the replicator could allow higher array size per plate. In the current screen zones of clearing were allowed to expand for 48 hours, however these are visible within 9 hours under a microscope. Incubation for only several hours and tools to observe minute degradation (<0.2mm zones of clearing) could make it feasible to screen several hundred mutants per plate and obtain a greater searchable sequence space. Such upgrades are deemed to increase the probability of finding effective mutants.

After making the library by error prone PCR, the mutated products were purified using QIAquick DNA Purification Kit and then cloned back into the source strain and into E. Coli with TOPO Cloning Kit from Invitrogen. The most active strains P. putida and Bacillus subtilis have not been mutated, as the current primers only amplify PAO1’s AlkB gene. Optimal Mg concentration was found to have a broad plateau from 5-10 uL of 50 mM solution per 50 uL reaction. Expected to increase the specificity of the reaction, there was however nonspecific activity at high concentrations while the second band moved from 300bp to 1800bp. This large concentration somewhat hampered PCR and is supposed resulting from the high 65% GC nucleotide content of PAO1 as well as non-specific activity during error-prone conditions. After a thermal gradient PCR reaction an optimal temperature with the highest yield and lowest rate of non-specific activity was found to be 58.5?C.

Of the 28 strains selected, 12 had significant (>0.5cm/24h at 37 ºC) hydrocarbon degrading activity on C20, the largest substrate screened. The observed zones of clearing had the following distribution: on the initial inoculation point centered a small colony encircled by a very thin layer of cells, itself surrounded by a thin ring of clearing that contains very few bacteria. Rate of growth on Eicosane to degradation rate had a significant Pearson correlation of 0.768, indicative of the number of cells and to a lesser extent the area covered.

Error Prone PCR
PCR buffer (5uL), MgCl2 (2uL), dNTP’s (1uL 2.5mM), alkB2-up (0.5uL), alkB2-down (0.5uL), Taq Polymerase (0.5uL), H2O (40uL), Template (0.5uL). A thermal cycler program called KP was used, 95C for 10 minutes, 55C for 10 minutes, 60C for 10 minutes, 36 cycles, total run time = 3hours.

M9 Media
[Na2HPO4 1.2g, KH2PO4 0.6g, NaCl 0.1g, NH4Cl 0.2g, H2O 100ml ]+[Agar 3g, H2O 100ml]+ MgSO4 (1M) 0.4ml, CaCl (1M) 0.02ml. Per 10 plates.

Surface Deposition of Hydrocarbon Substrates
Done in fume hood. 0.5g C10-C15, Napthalene, Eicosane (C20) / 10ml ether. 500uL x 2 spray at height of 30cm above plate from a narrow bore syringe, rapidly expelling to aerosolize an even layer.