Directed evolution was carried out on a Pseudomonas aeruginosa PAO1 strain of bacteria after screening of 28 known hydrocarbon utilizers for activity on alkanes of various chain lengths. PAO1's activity was improved from (0.6cm/24h at 37 C) to (0.9cm/24h at 37 C). Only one round of evolution was needed to achieve this improvement. After making the library by error prone PCR, the mutated products were purified using QIAquick DNA Purification Kit and then cloned back into the source strain and into E. Coli with TOPO Cloning Kit from Invitrogen. The most active strains P. putida and B. subtilis, which will be used in the rest of the project have not been mutated as the current primers only amplify PAO1's AlkB gene.

A plate-based assay using zones of clearing was developed to screen for hydrocarbon degrading activity. Of the 28 strains selected, 12 had significant (>0.5cm/24h at 37 C) activity on C20, the largest substrate screened. Primers for the PCR were designed by using NCBI nucleotide data for Pseudomonas aeruginosa PAO1 and BLAST of Alkane Monooxygenase, the first enzyme in the hydroxylation pathway. The upstream primer used was 5'ggcacccgaagcttccgtttcc 3' the downstream primer used was 5'gtctgagaattctcctccc 3'. With HindIII and EcoRI restriction sites.

Screening of the wild type and mutant strains was done on M9 medium without sucrose, sprayed with a thin layer of target substrate (0.5g/plate), strain success was measured by the presence and rate of zone of clearing. M9 media was used because it limits the carbon source to the target substrate. Napthalene, Catechol, C10-C15 and C20 substrates were screened.

Grade Grouping: 12
Team Size: 1
Subject Area: Biology
Project Type: Experimental
Project Level: Advanced
Project Format: Traditional

Software Tools:

• Macromedia Dreamweaver MX
• Macromedia Flash MX
• Adobe Photoshop 7
• Adobe Acrobat 5
• Adobe Premiere 6.5
• Microsoft Office 2003

Special Skills:

• HTML
• Flash ActionScript
• JavaScript

Hardware Tools:

• Sony Digital8 DV Camcorder
• PC with Windows XP
• PC with Windows 2000
• PC with SuSE Linux 9.0

Source of Idea:
I have always pursued an understanding of the sciences and my science fair projects have always been an extension of that. My interest in science fair is primarily in the research aspect, I delight in learning the methods which allow me to execute what I envision. My current research interests are in the fusion of genomics and protomics for creation of novel enzymes. My project, Directed Evolution of Hydrocarbon Degrading Bacteria uses directed evolution, using rounds of mutagenesis and selection to improve the activity towards compounds which are not readily degraded. I plan to pursue a degree in biochemistry with emphasis on protein chemistry.

Awards Recieved:

• Calgary Youth Science Fair (March 2004)
  • Gold Medal
  • Chancellor's Club Bursary
  • Grass Roots N.W. Senior Environmental Awareness Award
  • Government of Alberta Travel Scholarship
  • Top Senior Project Award
  • Top of Fair Award
• Aventis Biotech Challenge (Calgary, May 2004)
  • First Place Award
• Canada Wide Science Fair (St. John's, Newfoundland, May 2004)
  • Place on Team Calgary Awarded (fair has not yet taken place)
• Intel International Science and Engineering Fair (Portland, May 2004)
  • Place on Team Canada Awarded (fair has not yet taken place)

Website: http://www.alumni.ca/~lavr4v0 - posted on Virtual Science Fair website at http://www.virtualsciencefair.com.