Directed Evolution of Alkane Degrading Enzymes
home project info project video references and credits
introduction
background
objectives
process
methods
conclusions
applications
discussion
send e-mail
Welcome

Directed evolution was carried out on a Pseudomonas aeruginosa PAO1 strain of bacteria after screening of 28 known hydrocarbon utilizers for activity on alkanes of various chain lengths. PAO1's activity was improved from (0.6cm/24h at 37 C) to (0.9cm/24h at 37 C). Only one round of evolution was needed to achieve this improvement. After making the library by error prone PCR, the mutated products were purified using QIAquick DNA Purification Kit and then cloned back into the source strain and into E. Coli with TOPO Cloning Kit from Invitrogen. The most active strains P. putida and B. subtilis, which will be used in the rest of the project have not been mutated as the current primers only amplify PAO1's AlkB gene.

A plate-based assay using zones of clearing was developed to screen for hydrocarbon degrading activity. Of the 28 strains selected, 12 had significant (>0.5cm/24h at 37 C) activity on C20, the largest substrate screened. Primers for the PCR were designed by using NCBI nucleotide data for Pseudomonas aeruginosa PAO1 and BLAST of Alkane Monooxygenase, the first enzyme in the hydroxylation pathway. The upstream primer used was 5'ggcacccgaagcttccgtttcc 3' the downstream primer used was 5'gtctgagaattctcctccc 3'. With HindIII and EcoRI restriction sites.

Screening of the wild type and mutant strains was done on M9 medium without sucrose, sprayed with a thin layer of target substrate (0.5g/plate), strain success was measured by the presence and rate of zone of clearing. M9 media was used because it limits the carbon source to the target substrate. Napthalene, Catechol, C10-C15 and C20 substrates were screened.


Project Report

adobe acrobat

Adobe PDF - Project Report
Size: 0.36MB
Click here to Open (right-click, "save target as" to download)

Macromedia Flash Movies

macromedia flash

Introduction
Size: 0.16MB
Click here to Open (right-click, "save target as" to download)

NCBI Blast
Size: 0.20MB
Click here to Open (right-click, "save target as" to download)

PCR DNA Amplification
Size: 0.01MB
Click here to Open (right-click, "save target as" to download)

Topo Cloning Vector
Size: 0.80MB
Click here to Open (right-click, "save target as" to download)

Operon Organization and Bacterial Strains
Size: 1.28MB
Click here to Open (right-click, "save target as" to download)

Directed Evolution Method
Size: 0.02MB
Click here to Open (right-click, "save target as" to download)

Copyright © Vladislav Lavrovsky 2004. All Rights Reserved.
Website: http://www.alumni.ca/~lavr4v0. E-mail: vladic@shaw.ca.